Sequence retrieval

Genome: Bacillus cereus G9842
Start position: 3274108
End position: 3274131
Length: 24

DNA sequence
>NC_011772, from 3274108 to 3274131 (24 bp); Bacillus cereus G9842 TTCTCTTCCTCTTCCTCTTTCACT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3274072-3274491	Sequence	BCG9842_B1856 - ATP synthase I (Protein is coded in complementary strand; from 3274491 to 3274072)