Sequence retrieval

Genome: Bacillus cereus G9842
Start position: 2881996
End position: 2882019
Length: 24

DNA sequence
>NC_011772, from 2881996 to 2882019 (24 bp); Bacillus cereus G9842 TCTTTTTCTTCTTCTTTAACTTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2881408-2882910	Sequence	BCG9842_B2273 - enterotoxin (Protein is coded in complementary strand; from 2882910 to 2881408)