Sequence retrieval

Genome: Bacillus cereus G9842
Start position: 2619984
End position: 2620007
Length: 24

DNA sequence
>NC_011772, from 2619984 to 2620007 (24 bp); Bacillus cereus G9842 GAAAAAGAAAGAGAAATAGAAACA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2619259-2620698	Sequence	BCG9842_B2562 - integral membrane sensor signal transduction histidine kinase