Sequence retrieval

Genome: Bacillus cereus G9842
Start position: 1051248
End position: 1051271
Length: 24

DNA sequence
>NC_011772, from 1051248 to 1051271 (24 bp); Bacillus cereus G9842 TGTGCTTGTCCTTCTGCTTGTGCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1051170-1051667	Sequence	BCG9842_B4204 - hypothetical protein (Protein is coded in complementary strand; from 1051667 to 1051170)