Sequence retrieval

Genome: Shewanella baltica OS223
Start position: 3448415
End position: 3448474
Length: 60

DNA sequence
>NC_011663, from 3448415 to 3448474 (60 bp); Shewanella baltica OS223 GCGTCAAACAGCGCATCAAAAAGCGCGTCAAAAAGCGCGTCAAAAAGCGCGTCAAAAATC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3448365-3454310	Sequence	Sbal223_2931 - beta-hydroxyacyl-(acyl-carrier-protein) dehydratase FabA/FabZ