Sequence retrieval

Genome: Shewanella baltica OS223
Start position: 3231645
End position: 3231700
Length: 56

DNA sequence
>NC_011663, from 3231645 to 3231700 (56 bp); Shewanella baltica OS223 CTAAGTTCTAAGTTCTAAGTTCTAAGTTCTAAGTTCTAAGTTCTAAGTTCTAAGTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 3230795-3231649	Sequence	Sbal223_2752 - bifunctional 5,10-methylene-tetrahydrofolate dehydrogenase/ 5,10-methylene-tetrahydrofolate cyclohydrolase