Sequence retrieval

Genome: Shewanella baltica OS223
Start position: 1302636
End position: 1302689
Length: 54

DNA sequence
>NC_011663, from 1302636 to 1302689 (54 bp); Shewanella baltica OS223 CTAATGTGAGTGCTGTGCCCAATGTAAATGCTGTGCCCAATGTAAATGCTGTGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1302329-1302754	Sequence	Sbal223_1107 - hypothetical protein (Protein is coded in complementary strand; from 1302754 to 1302329)