Sequence retrieval

Genome: Shewanella baltica OS223
Start position: 2212148
End position: 2212198
Length: 51

DNA sequence
>NC_011663, from 2212148 to 2212198 (51 bp); Shewanella baltica OS223 AATTTCAGCTAATAACTAATTTCAGTTAAAAACTAAGTTCAGTTAAAAACT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 2212199-2213569	Sequence	Sbal223_1871 - adenylosuccinate lyase (Protein is coded in complementary strand; from 2213569 to 2212199)