Sequence retrieval

Genome: Shewanella baltica OS223
Start position: 998736
End position: 998780
Length: 45

DNA sequence
>NC_011663, from 998736 to 998780 (45 bp); Shewanella baltica OS223 GAACTGTTGTTTGTGGAGCTGTTGTTTGCAGAGTTGTTTTTTGTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 997880-999094	Sequence	Sbal223_0854 - hypothetical protein (Protein is coded in complementary strand; from 999094 to 997880)