Sequence retrieval

Genome: Shewanella baltica OS223
Start position: 670152
End position: 670196
Length: 45

DNA sequence
>NC_011663, from 670152 to 670196 (45 bp); Shewanella baltica OS223 TAGGTTTATACTGCTTGGGCTTATACCGCTTAGATTTATGCCGCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 669091-670287	Sequence	Sbal223_0584 - peptidase M28 (Protein is coded in complementary strand; from 670287 to 669091)