Sequence retrieval

Genome: Shewanella baltica OS223
Start position: 3571317
End position: 3571361
Length: 45

DNA sequence
>NC_011663, from 3571317 to 3571361 (45 bp); Shewanella baltica OS223 TTGGGCTTAGCTTATTTTGGCTTAACTTATTTAGACTTAGCTCAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 3571359-3572777	Sequence	Sbal223_3021 - DEAD/DEAH box helicase (Protein is coded in complementary strand; from 3572777 to 3571359)