Sequence retrieval

Genome: Shewanella baltica OS223
Start position: 3509708
End position: 3509752
Length: 45

DNA sequence
>NC_011663, from 3509708 to 3509752 (45 bp); Shewanella baltica OS223 TTCACCGACAGTGCCTTTATCGACAGCGCCTTTATCGACAGCGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3509409-3509942	Sequence	Sbal223_2973 - N-acetyltransferase GCN5 (Protein is coded in complementary strand; from 3509942 to 3509409)