Sequence retrieval

Genome: Shewanella baltica OS223
Start position: 1001669
End position: 1001713
Length: 45

DNA sequence
>NC_011663, from 1001669 to 1001713 (45 bp); Shewanella baltica OS223 TTTGCTTAAGCTCAGTTTGCTTAAGTTCTATCTGCTTAAGTTCTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 999094-1001748	Sequence	Sbal223_0855 - hypothetical protein (Protein is coded in complementary strand; from 1001748 to 999094)