Sequence retrieval

Genome: Shewanella baltica OS223
Start position: 3069251
End position: 3069289
Length: 39

DNA sequence
>NC_011663, from 3069251 to 3069289 (39 bp); Shewanella baltica OS223 CTTAACGTATAAGCTTAACGCATAGGCTTAACGTATAAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 3069279-3070004	Sequence	Sbal223_2579 - phage minor tail protein L (Protein is coded in complementary strand; from 3070004 to 3069279)