Sequence retrieval

Genome: Shewanella baltica OS223
Start position: 738239
End position: 738274
Length: 36

DNA sequence
>NC_011663, from 738239 to 738274 (36 bp); Shewanella baltica OS223 ATTAATGCTTTAAATAATGTTTTAAATAATGCTTTA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 736671-739517	Sequence	Sbal223_0622 - P pilus assembly protein porin PapC-like protein