Sequence retrieval

Genome: Shewanella baltica OS223
Start position: 667871
End position: 667906
Length: 36

DNA sequence
>NC_011663, from 667871 to 667906 (36 bp); Shewanella baltica OS223 CCAGTACGGCCAGCACGGCCTGTACGGCCAATACGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 666974-668896	Sequence	Sbal223_0583 - DEAD/DEAH box helicase (Protein is coded in complementary strand; from 668896 to 666974)