Sequence retrieval

Genome: Shewanella baltica OS223
Start position: 382065
End position: 382100
Length: 36

DNA sequence
>NC_011663, from 382065 to 382100 (36 bp); Shewanella baltica OS223 TGCACCATAATCAGCTCCATAATCAGCTCCATAATC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 381496-384039	Sequence	Sbal223_0341 - hypothetical protein (Protein is coded in complementary strand; from 384039 to 381496)