Sequence retrieval

Genome: Shewanella baltica OS223
Start position: 2885606
End position: 2885641
Length: 36

DNA sequence
>NC_011663, from 2885606 to 2885641 (36 bp); Shewanella baltica OS223 CATGATCACGGTCATGATCATGATCATGATCATGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2885514-2886371	Sequence	Sbal223_2411 - hydrogenase nickel incorporation protein HypB