Sequence retrieval

Genome: Shewanella baltica OS223
Start position: 2575238
End position: 2575273
Length: 36

DNA sequence
>NC_011663, from 2575238 to 2575273 (36 bp); Shewanella baltica OS223 TACTATGGTTGAAACTATGGTTGAAACTGTGGTTGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2574877-2575869	Sequence	Sbal223_2162 - SMP-30/gluconolaconase/LRE domain-containing protein