Sequence retrieval

Genome: Shewanella baltica OS223
Start position: 2380786
End position: 2380821
Length: 36

DNA sequence
>NC_011663, from 2380786 to 2380821 (36 bp); Shewanella baltica OS223 TTATCGTTTGAGTTAGCGTTTGAGTTAGCGTTTGTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2380122-2381048	Sequence	Sbal223_2016 - AraC family transcriptional regulator (Protein is coded in complementary strand; from 2381048 to 2380122)