Sequence retrieval

Genome: Shewanella baltica OS223
Start position: 4364133
End position: 4364165
Length: 33

DNA sequence
>NC_011663, from 4364133 to 4364165 (33 bp); Shewanella baltica OS223 ACTCAAATTCAACTCAAGCTCAACTCAAGCTCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 4362087-4364135	Sequence	Sbal223_3676 - histidine kinase (Protein is coded in complementary strand; from 4364135 to 4362087)