Sequence retrieval

Genome: Shewanella baltica OS223
Start position: 3288579
End position: 3288605
Length: 27

DNA sequence
>NC_011663, from 3288579 to 3288605 (27 bp); Shewanella baltica OS223 GCTTGAGTTGCTTGAGTCACTTGAGTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3287976-3289184	Sequence	Sbal223_2797 - 3-beta hydroxysteroid dehydrogenase/isomerase (Protein is coded in complementary strand; from 3289184 to 3287976)