Sequence retrieval

Genome: Shewanella baltica OS223
Start position: 1142016
End position: 1142042
Length: 27

DNA sequence
>NC_011663, from 1142016 to 1142042 (27 bp); Shewanella baltica OS223 ATTGTTATCTTTGTTATCTTTGTTATC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1141657-1142409	Sequence	Sbal223_0972 - family 3 extracellular solute-binding protein (Protein is coded in complementary strand; from 1142409 to 1141657)