Sequence retrieval

Genome: Shewanella baltica OS223
Start position: 3381044
End position: 3381067
Length: 24

DNA sequence
>NC_011663, from 3381044 to 3381067 (24 bp); Shewanella baltica OS223 GGTTTGGGTTTGGATTTGGGTTTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3380443-3381612	Sequence	Sbal223_2879 - dTDP-4-dehydrorhamnose reductase (Protein is coded in complementary strand; from 3381612 to 3380443)