Sequence retrieval

Genome: Shewanella baltica OS223
Start position: 1748081
End position: 1748104
Length: 24

DNA sequence
>NC_011663, from 1748081 to 1748104 (24 bp); Shewanella baltica OS223 AGCACCAGCAGCAGTACCAACACC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1747941-1748231	Sequence	Sbal223_1499 - hypothetical protein (Protein is coded in complementary strand; from 1748231 to 1747941)