Sequence retrieval

Genome: Shewanella baltica OS223
Start position: 1011256
End position: 1011279
Length: 24

DNA sequence
>NC_011663, from 1011256 to 1011279 (24 bp); Shewanella baltica OS223 ATGCTCGAATGCTCGAATGCTTGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 1010241-1011257	Sequence	Sbal223_0859 - response regulator receiver modulated metal dependent phosphohydrolase