Sequence retrieval

Genome: Streptococcus pyogenes NZ131
Start position: 735075
End position: 735098
Length: 24

DNA sequence
>NC_011375, from 735075 to 735098 (24 bp); Streptococcus pyogenes NZ131 ACAGCACCAGCAACAGTAGCAGCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 734976-735152	Sequence	Spy49_0729c - hypothetical protein (Protein is coded in complementary strand; from 735152 to 734976)