Sequence retrieval

Genome: Streptococcus pyogenes NZ131
Start position: 327617
End position: 327646
Length: 30

DNA sequence
>NC_011375, from 327617 to 327646 (30 bp); Streptococcus pyogenes NZ131 ATGGCAAATAAAGGCAAGTAATGGCTGATA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 326993-328030	Sequence	Spy49_0315 fhuG ferrichrome ABC transporter permease (Protein is coded in complementary strand; from 328030 to 326993)