Sequence retrieval

Genome: Streptococcus pyogenes NZ131
Start position: 1655935
End position: 1655958
Length: 24

DNA sequence
>NC_011375, from 1655935 to 1655958 (24 bp); Streptococcus pyogenes NZ131 GCTTCTGCTTCTGCTGCTGCTTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1655083-1656330	Sequence	Spy49_1672c - Fc-gamma receptor (Protein is coded in complementary strand; from 1656330 to 1655083)