Sequence retrieval

Genome: Streptococcus pyogenes NZ131
Start position: 1561887
End position: 1561913
Length: 27

DNA sequence
>NC_011375, from 1561887 to 1561913 (27 bp); Streptococcus pyogenes NZ131 CTTTTTCCACCTTTTCCACTTATTCCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1561242-1562867	Sequence	Spy49_1582c salB salivaricin A modification enzyme, amino acid dehydration (Protein is coded in complementary strand; from 1562867 to 1561242)