Sequence retrieval

Genome: Streptococcus pyogenes NZ131
Start position: 1535882
End position: 1535911
Length: 30

DNA sequence
>NC_011375, from 1535882 to 1535911 (30 bp); Streptococcus pyogenes NZ131 TTCTTCATCTTCTTCATCTTCTTCGTCTTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1535871-1536479	Sequence	Spy49_1562c rpoE DNA-directed RNA polymerase subunit delta (Protein is coded in complementary strand; from 1536479 to 1535871)