Sequence retrieval

Genome: Streptococcus pyogenes NZ131
Start position: 1496634
End position: 1496669
Length: 36

DNA sequence
>NC_011375, from 1496634 to 1496669 (36 bp); Streptococcus pyogenes NZ131 CTTTATATCTATATTTATATCTATCTTTTTATCTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1495522-1497093	Sequence	Spy49_1506c - DNA replication protein DnaC (Protein is coded in complementary strand; from 1497093 to 1495522)