Sequence retrieval

Genome: Streptococcus pyogenes NZ131
Start position: 1411363
End position: 1411416
Length: 54

DNA sequence
>NC_011375, from 1411363 to 1411416 (54 bp); Streptococcus pyogenes NZ131 TGGTTTGGGCTGATCAGTCGGTTTTGGCTGGTCAGTTGGTTTCGAATGATCAGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1410242-1411753	Sequence	Spy49_1407c isp2 Immunogenic secreted protein (Protein is coded in complementary strand; from 1411753 to 1410242)