Sequence retrieval

Genome: Streptococcus pyogenes NZ131
Start position: 1320858
End position: 1320884
Length: 27

DNA sequence
>NC_011375, from 1320858 to 1320884 (27 bp); Streptococcus pyogenes NZ131 TTTTCAAACTTTTCAAAGTTTTCAAGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1320606-1321523	Sequence	Spy49_1311c glyQ glycyl-tRNA synthetase subunit alpha (Protein is coded in complementary strand; from 1321523 to 1320606)