Sequence retrieval

Genome: Streptococcus pyogenes NZ131
Start position: 1144175
End position: 1144210
Length: 36

DNA sequence
>NC_011375, from 1144175 to 1144210 (36 bp); Streptococcus pyogenes NZ131 TTCATCTAATTCATCTAATTCATCTAATTCATCTAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1143573-1144529	Sequence	Spy49_1151c - hypothetical protein (Protein is coded in complementary strand; from 1144529 to 1143573)