Sequence retrieval

Genome: Gluconacetobacter diazotrophicus PAl 5
Start position: 779249
End position: 779272
Length: 24

DNA sequence
>NC_011365, from 779249 to 779272 (24 bp); Gluconacetobacter diazotrophicus PAl 5 TTCCTGATCCTGGTCCTGTTCCTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 778215-781316	Sequence	Gdia_0687 - CzcA family heavy metal efflux pump