Sequence retrieval

Genome: Gluconacetobacter diazotrophicus PAl 5
Start position: 673538
End position: 673567
Length: 30

DNA sequence
>NC_011365, from 673538 to 673567 (30 bp); Gluconacetobacter diazotrophicus PAl 5 GCCGCGTGCGGCCGCGACCGGCCGCATCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 672827-673789	Sequence	Gdia_0601 - proline iminopeptidase (Protein is coded in complementary strand; from 673789 to 672827)