Sequence retrieval

Genome: Gluconacetobacter diazotrophicus PAl 5
Start position: 539491
End position: 539514
Length: 24

DNA sequence
>NC_011365, from 539491 to 539514 (24 bp); Gluconacetobacter diazotrophicus PAl 5 GCCGGTGCCGGCGCTGGTGCCGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 538612-541068	Sequence	Gdia_0491 - AsmA family protein (Protein is coded in complementary strand; from 541068 to 538612)