Sequence retrieval

Genome: Gluconacetobacter diazotrophicus PAl 5
Start position: 538039
End position: 538062
Length: 24

DNA sequence
>NC_011365, from 538039 to 538062 (24 bp); Gluconacetobacter diazotrophicus PAl 5 GGCCAGGGCCAGGCCCAGGACCAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 537875-538615	Sequence	Gdia_0490 - ATP12 ATPase (Protein is coded in complementary strand; from 538615 to 537875)