Sequence retrieval

Genome: Gluconacetobacter diazotrophicus PAl 5
Start position: 488801
End position: 488827
Length: 27

DNA sequence
>NC_011365, from 488801 to 488827 (27 bp); Gluconacetobacter diazotrophicus PAl 5 CGCCATGCGCGCCTTGCGCGTCATGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 488616-489818	Sequence	Gdia_0444 - deoxyguanosinetriphosphate triphosphohydrolase (Protein is coded in complementary strand; from 489818 to 488616)