Sequence retrieval

Genome: Gluconacetobacter diazotrophicus PAl 5
Start position: 486167
End position: 486211
Length: 45

DNA sequence
>NC_011365, from 486167 to 486211 (45 bp); Gluconacetobacter diazotrophicus PAl 5 ACGGGCGCTGCCGTTACCGGCGGTGCCGCTGCTGGCGCTGCCGGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 485816-486742	Sequence	Gdia_0442 - sporulation domain-containing protein (Protein is coded in complementary strand; from 486742 to 485816)