Sequence retrieval

Genome: Gluconacetobacter diazotrophicus PAl 5
Start position: 483440
End position: 483484
Length: 45

DNA sequence
>NC_011365, from 483440 to 483484 (45 bp); Gluconacetobacter diazotrophicus PAl 5 ATCGGCTGGTCGTTGATCGGATCGGCGTTGATCGGATCGTCGTTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 482678-483442	Sequence	Gdia_0438 - Sec-independent protein translocase subunit TatC (Protein is coded in complementary strand; from 483442 to 482678)