Sequence retrieval

Genome: Gluconacetobacter diazotrophicus PAl 5
Start position: 432610
End position: 432633
Length: 24

DNA sequence
>NC_011365, from 432610 to 432633 (24 bp); Gluconacetobacter diazotrophicus PAl 5 GCTGCTTCTGCTTCTGCTGCTGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 432399-432779	Sequence	Gdia_0394 - preprotein translocase subunit YajC (Protein is coded in complementary strand; from 432779 to 432399)