Sequence retrieval

Genome: Gluconacetobacter diazotrophicus PAl 5
Start position: 3882898
End position: 3882921
Length: 24

DNA sequence
>NC_011365, from 3882898 to 3882921 (24 bp); Gluconacetobacter diazotrophicus PAl 5 CCAGCACCGGCACCAGCACCAGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3881481-3883208	Sequence	Gdia_3546 - binding-protein-dependent transport system inner membrane protein (Protein is coded in complementary strand; from 3883208 to 3881481)