Sequence retrieval

Genome: Gluconacetobacter diazotrophicus PAl 5
Start position: 3684118
End position: 3684141
Length: 24

DNA sequence
>NC_011365, from 3684118 to 3684141 (24 bp); Gluconacetobacter diazotrophicus PAl 5 TGCCGCTGCCGTTGCGGCTGCCGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3683889-3684962	Sequence	Gdia_3363 - DegT/DnrJ/EryC1/StrS aminotransferase