Sequence retrieval

Genome: Gluconacetobacter diazotrophicus PAl 5
Start position: 3600435
End position: 3600470
Length: 36

DNA sequence
>NC_011365, from 3600435 to 3600470 (36 bp); Gluconacetobacter diazotrophicus PAl 5 GACGGCGCGGCTGACGGCATGGCTGACGGGGCGGCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3600340-3601035	Sequence	Gdia_3295 - MerR family transcriptional regulator