Sequence retrieval

Genome: Gluconacetobacter diazotrophicus PAl 5
Start position: 3509281
End position: 3509310
Length: 30

DNA sequence
>NC_011365, from 3509281 to 3509310 (30 bp); Gluconacetobacter diazotrophicus PAl 5 GGCTGGTGCTGGGGCTGGCGCTGGGCCTGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3508807-3510273	Sequence	Gdia_3206 - putative 4-amino-4-deoxy-L-arabinose transferase