Sequence retrieval

Genome: Gluconacetobacter diazotrophicus PAl 5
Start position: 3443055
End position: 3443078
Length: 24

DNA sequence
>NC_011365, from 3443055 to 3443078 (24 bp); Gluconacetobacter diazotrophicus PAl 5 CTGTCGCGGTCGCTGCCGGTGTCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3442060-3443382	Sequence	Gdia_3145 - major facilitator superfamily protein