Sequence retrieval

Genome: Gluconacetobacter diazotrophicus PAl 5
Start position: 3414362
End position: 3414406
Length: 45

DNA sequence
>NC_011365, from 3414362 to 3414406 (45 bp); Gluconacetobacter diazotrophicus PAl 5 CGTCATCGGATGTCACGTCATCGGATGTCACGTCATCGGGCGCCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3413491-3414510	Sequence	Gdia_3117 - uroporphyrin-III C/tetrapyrrole (Corrin/Porphyrin) methyltransferase (Protein is coded in complementary strand; from 3414510 to 3413491)