Sequence retrieval

Genome: Gluconacetobacter diazotrophicus PAl 5
Start position: 3356421
End position: 3356456
Length: 36

DNA sequence
>NC_011365, from 3356421 to 3356456 (36 bp); Gluconacetobacter diazotrophicus PAl 5 GGTCCGGGGAAGGGCCCAGGGAAGGGCCCAGGGAAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3355208-3356491	Sequence	Gdia_3066 - alpha/beta hydrolase fold protein (Protein is coded in complementary strand; from 3356491 to 3355208)